yfiF
 
Information for yfiF, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2714774-2715463
+
CDS
uracil-DNA-glycosylase
2715511-2716548
-
CDS
yfiF
orf; hypothetical protein
2716755-2717174
+
CDS
putative thioredoxin-like protein
 
Reported regulatory sites for yfiF:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
6.775
2716563-2716578 R
tctgc GCGCTTCGCGCAGCGC tggtg
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.355
2716584-2716605 R
atggc GAACCGCGCGGACTTCGGGTAA tctgc
-
0
-
4.347
2716607-2716630 R
tagtc GCAGGCTTTGGTACGAAATCATGG cgaac
oxyR
12
-
 
Critical MAP values:
p=0.01
6.66
p=0.05
5.31
p=0.1
4.59
p=0.2
3.95

Click here to go back