ygaD

Information for ygaD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2820731-2821792 - CDS recA EG10823 DNA strand exchange and renaturation; DNA-dependent ATPase; DNA- and ATP-dependent coprotease 2821872-2822369 - CDS ygaD EG12698 orf; hypothetical protein 2822514-2823599 - CDS mltB EG12699 membrane-bound lytic murein transglycosylase B

Reported regulatory sites for ygaD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.657 2822445-2822467 R agctt TTTTCTGAATCCTCCTCGTAAAA ttgca - 0 - 1.064 2822412-2822430 R caaca CCATCTTCCTGACGAAAGT gctat - 0 - 1.064 2822374-2822392 R cataa ATTTTTGACTGACAGAGGT tgtga - 0 - 0.883 2822482-2822503 R tacaa GAGGGGGGCGTGAGCTTCCCTC tggct - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back