ygdH
 
Information for ygdH, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2923370-2924218
+
CDS
orf; hypothetical protein
2924330-2925694
+
CDS
ygdH
orf; hypothetical protein
2926251-2927540
+
CDS
probable serine transporter
 
Reported regulatory sites for ygdH:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.121
2924259-2924277
aaggt TGTGAAAGGTCATCAGGCA gggct
-
0
-
1.109
2924228-2924247
tttct CAATTTTGCGTGCTGGATTC acgca
-
0
-
0.961
2924276-2924298
tcagg CAGGGCTATTGTAATCAAAGGGA atgac
-
0
-
 
Critical MAP values:
p=0.01
5.41
p=0.05
4.01
p=0.1
3.43
p=0.2
2.86

Click here to go back