ygdL
 
Information for ygdL, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2942564-2943007
+
CDS
orf; hypothetical protein
2943058-2943864
-
CDS
ygdL
putative enzyme
2944103-2945200
-
CDS
membrane-bound lytic murein transglycosylase A
 
Reported regulatory sites for ygdL:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
5.025
2944047-2944065 R
gacag GGTGAGGGGTAACCTCACA tcctg
-
0
-
5.025
2943885-2943903 R
tttag GGTGAGGGATAACCTCGCC ctttt
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.769
2943978-2943993 R
acgcc TTATCCGGCCTACAAA tcatg
-
0
REP206b (13)
1.769
2943934-2943949 R
ggagt TATGTAGGCCTGATAA gcgta
-
0
REPv206a (13)
0.582
2943953-2943976 R
caaat CATGCAAATCCAAAATATTGCAGG agtta
-
0
-
 
Critical MAP values:
p=0.01
5.41
p=0.05
4.01
p=0.1
3.43
p=0.2
2.86

Click here to go back