ygdL

Information for ygdL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2942564-2943007 + CDS ygdK EG13083 orf; hypothetical protein 2943058-2943864 - CDS ygdL EG13084 putative enzyme 2944103-2945200 - CDS mltA EG13085 membrane-bound lytic murein transglycosylase A

Reported regulatory sites for ygdL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.025 2944047-2944065 R gacag GGTGAGGGGTAACCTCACA tcctg - 0 - 5.025 2943885-2943903 R tttag GGTGAGGGATAACCTCGCC ctttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.769 2943978-2943993 R acgcc TTATCCGGCCTACAAA tcatg - 0 REP206b (13) 1.769 2943934-2943949 R ggagt TATGTAGGCCTGATAA gcgta - 0 REPv206a (13) 0.582 2943953-2943976 R caaat CATGCAAATCCAAAATATTGCAGG agtta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back