ygeA

Information for ygeA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2977043-2977978 + CDS lysR EG10551 positive regulator for lys 2977965-2978657 - CDS ygeA EG11157 putative resistance proteins 2978786-2980204 - CDS araE EG10056 low-affinity L-arabinose transport system proton symport protein

Reported regulatory sites for ygeA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.858 2978758-2978774 R gggcc GGATGTGCTGTACATCC ggccc - 0 REPt208 (17) - 0.012 2978675-2978698 R gttcc TTATTCAGCCTTGTTGCGGTAACA cacat - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back