ygfF
 
Information for ygfF, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3041682-3043121
+
CDS
6-phospho-beta-glucosidase A; cryptic
3043178-3043921
-
CDS
ygfF
putative oxidoreductase
3044188-3047061
-
CDS
glycine decarboxylase; P protein of glycine cleavage system
 
Reported regulatory sites for ygfF:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP ST EC VC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
0.581
3043930-3043950 R
tacgt CAACGAATTAATTTTTCTCGG aaaaa
-
0
-
0.470
3043946-3043969 R
ttgtt AGCAATCTCAAAGATACGTCAACG aatta
-
0
-
0.222
3044057-3044074 R
gtgag GGGAACAGGCCGGCACTG gcgcg
-
0
BOXC15 (7)
 
Critical MAP values:
p=0.01
5.40
p=0.05
4.29
p=0.1
3.77
p=0.2
3.19

Click here to go back