ygfY
 
Information for ygfY, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3038436-3038843
-
CDS
orf; hypothetical protein
3038824-3039090
-
CDS
ygfY
orf; hypothetical protein
3039333-3040313
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for ygfY:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.331
3039150-3039169 R
tggtg TTTACTGATATTCCCGTAAA agaag
-
0
-
3.204
3039110-3039133 R
aacac GTTACAATAGCCGGGTACTGGATT ttcgt
-
0
-
2.677
3039173-3039188 R
attaa TTTCGCGATCGCGATG gtgtt
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back