yggG
 
Information for yggG, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3077663-3079654
-
CDS
transketolase 1 isozyme
3079806-3080690
+
CDS
yggG
orf; hypothetical protein
3080896-3081816
-
CDS
agmatinase
 
Reported regulatory sites for yggG:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
5.844
3079691-3079712
ccctt AACGACTTGACGACAGCGCGTT ttggg
-
0
-
5.818
3079749-3079764
taccg CAAGCCGCGCGTCATG tacat
-
0
-
5.434
3079725-3079746
acgcc GGAAAATTTGCCAACAATTTAC cgcaa
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back