yghB
 
Information for yghB, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3150251-3151438
+
CDS
cystathionine beta-lyase (beta-cystathionase)
3151578-3152237
+
CDS
yghB
orf; hypothetical protein
3152276-3153403
-
CDS
putative ARAC-type regulatory protein
 
Reported regulatory sites for yghB:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.582
3151499-3151520
ttgcg TCCGGGATCAAGGCGTCCCGGA cgatt
-
0
-
4.051
3151514-3151530
aggcg TCCCGGACGATTCAGGA gtaca
-
0
-
2.737
3151465-3151486
ttgca GACATTTTATTGTGAAAAGTCT taaat
-
0
-
2.737
3151556-3151577
cttaa ACGCTGTTCCACAGGAAAGTCC atggc
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back