yghB

Information for yghB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3150251-3151438 + CDS metC EG10583 cystathionine beta-lyase (beta-cystathionase) 3151578-3152237 + CDS yghB EG11824 orf; hypothetical protein 3152276-3153403 - CDS yqhC EG13013 putative ARAC-type regulatory protein

Reported regulatory sites for yghB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.582 3151499-3151520 ttgcg TCCGGGATCAAGGCGTCCCGGA cgatt - 0 - 4.051 3151514-3151530 aggcg TCCCGGACGATTCAGGA gtaca - 0 - 2.737 3151465-3151486 ttgca GACATTTTATTGTGAAAAGTCT taaat - 0 - 2.737 3151556-3151577 cttaa ACGCTGTTCCACAGGAAAGTCC atggc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back