ygiF
 
Information for ygiF, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3194442-3197282
-
CDS
adenylylating enzyme for glutamine synthetase
3197305-3198606
-
CDS
ygiF
orf; hypothetical protein
3198848-3199468
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for ygiF:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.958
3198794-3198816 R
tggaa CGATAGTAGTGGCATCAGTGTCG ctacg
-
0
-
2.958
3198650-3198672 R
actga CAAAAAAGATCGCATTAAGTTCG ccgtt
-
0
-
2.238
3198713-3198734 R
cttca AACTTTTACGCCCGTCAAATTG cccgt
-
0
-
2.238
3198623-3198644 R
ccgtt CATCGTCACTTATGTGACATAA ccgat
-
0
-
1.835
3198680-3198703 R
ttgca TGGCAATTTGGCGCAAAATACTAT ctact
-
0
-
 
Critical MAP values:
p=0.01
4.80
p=0.05
3.45
p=0.1
2.95
p=0.2
2.42

Click here to go back