ygjG
 
Information for ygjG, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3215197-3216717
-
CDS
aerotaxis sensor receptor; flavoprotein
3217024-3218514
+
CDS
ygjG
probable ornithine aminotransferase
3218556-3218888
-
CDS
putative tRNA synthetase
 
Reported regulatory sites for ygjG:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
7.477
3216810-3216830
tgatt TAGATCGCAATTTGCGATTTA aacac
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.914
3216983-3216999
gcaaa ATAACAACAAATGTTAA cagat
-
0
-
1.899
3216998-3217017
atgtt AACAGATAGCATTAAATATT gcaca
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back