ygjH
 
Information for ygjH, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3217024-3218514
+
CDS
probable ornithine aminotransferase
3218556-3218888
-
CDS
ygjH
putative tRNA synthetase
3219107-3220090
+
CDS
regulator of ebg operon
 
Reported regulatory sites for ygjH:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: EC VC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.183
3218922-3218942 R
cagga TTGAGAAAAACTTTTGCTATA gttta
-
0
-
2.183
3218900-3218920 R
tatag TTTAGTAAAATTTTACCCTAA gggag
-
0
-
1.874
3219021-3219044 R
ggtca CCTGTTTTCAGTAAATAAAGCGCG tttct
-
0
-
 
Critical MAP values:
p=0.01
3.34
p=0.05
2.41
p=0.1
2.01
p=0.2
1.55

Click here to go back