ygjH

Information for ygjH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3217024-3218514 + CDS ygjG EG12718 probable ornithine aminotransferase 3218556-3218888 - CDS ygjH EG12719 putative tRNA synthetase 3219107-3220090 + CDS ebgR EG10254 regulator of ebg operon

Reported regulatory sites for ygjH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.183 3218922-3218942 R cagga TTGAGAAAAACTTTTGCTATA gttta - 0 - 2.183 3218900-3218920 R tatag TTTAGTAAAATTTTACCCTAA gggag - 0 - 1.874 3219021-3219044 R ggtca CCTGTTTTCAGTAAATAAAGCGCG tttct - 0 -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back