yhaU

Information for yhaU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3270428-3271198 - CDS yhaF EG10016 orf; hypothetical protein 3271214-3272548 - CDS yhaU EG12760 putative transport protein 3272923-3274494 + CDS yhaG EG12522 putative hydrolase

Reported regulatory sites for yhaU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.588 3272737-3272756 R cgcaa ATCTGTGCTTTAGCGCGCAA cctta - 0 - 2.588 3272715-3272734 R caacc TTATGTGCATATGCTCAAAA taata - 0 - 1.365 3272846-3272869 R attta AAAATAAATGACTTCATTGGGTGA aataa - 0 - 0.000 3272699-3272714 R caaaa TAATATTTAAATAGTA ttaat - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back