yhbM

Information for yhbM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3303612-3305552 - CDS deaD EG10215 inducible ATP-independent RNA helicase 3305681-3306565 - CDS yhbM EG12371 putative control proteins 3306674-3308878 - CDS pnp EG10743 polynucleotide phosphorylase; cytidylate kinase activity

Reported regulatory sites for yhbM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.813 3306567-3306584 R aaccg TGGTCTTCGGGAGTGGGA aatga - 0 - 2.531 3306616-3306631 R aaccg GGCAGGACGCCTTGTT agcaa - 0 - 2.531 3306590-3306605 R ccggg AACAGGACGTTCATTC aaccg - 0 - 1.785 3306654-3306675 R cgagt AAGGTTGCCATTTGCCCTCCGC tgcgg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back