yhbT

Information for yhbT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3297896-3298399 - CDS yhbS EG12788 orf; hypothetical protein 3298393-3298917 - CDS yhbT EG12789 orf; hypothetical protein 3299126-3300121 + CDS yhbU EG12790 putative collagenase

Reported regulatory sites for yhbT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.777 3299063-3299086 R aaatg TTAACGAACTGGGATTTTAGTTAA ccttg - 0 - 2.200 3299006-3299022 R agttg TATTGGTGGTAGCAGCA atttc - 0 - 2.146 3299030-3299047 R acaat TTTTGATTTAAGGCAGTT aaagt - 0 - 2.146 3298974-3298991 R ggaat TGTTGATTTATACCGCTA tgtta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back