yhcB

Information for yhcB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3376505-3377632 - CDS yhcM EG12819 orf; hypothetical protein 3377820-3378224 + CDS yhcB EG12614 orf; hypothetical protein 3378378-3379745 + CDS degQ EG12612 serine endoprotease

Reported regulatory sites for yhcB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.333 3377684-3377707 ttgac GAAAAAAAGGCCGTTCTACACTAC gcgat - 0 - 3.333 3377710-3377733 tacgc GATATGCAGTCGGGATTCCACTTC tgtgg - 0 - 3.269 3377776-3377798 ggcat GGAGCCTGAAGCCAACACCCTAC ggaaa - 0 - 3.238 3377641-3377660 cttat TGTTATTCCTTGAATAATCG gtgcg - 0 - 3.238 3377745-3377764 attaa CGGTTATAGTGGCATAATCA gccgc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back