yhdA

Information for yhdA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3397681-3398784 - CDS mreB EG10608 regulator of ftsI; penicillin binding protein 3; septation function 3399029-3400969 - CDS yhdA EG10018 orf; hypothetical protein 3401121-3402095 + CDS yhdH EG11315 putative dehydrogenase

Reported regulatory sites for yhdA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.826 3401011-3401033 R gcaat AAATTGCGAGATAAATCTGATTT gctag - 0 - 1.856 3400989-3401010 R gattt GCTAGTATGCCCGCTTCCTCAC tatcg - 0 - 1.854 3401068-3401091 R attgg AAAATAATTTCTGAAGACTATACT cgcta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back