yhfL

Information for yhfL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3495465-3496838 + CDS cysG EG10188 uroporphyrinogen III methylase; sirohaeme biosynthesis 3497085-3497252 + CDS yhfL EG12907 orf; hypothetical protein 3497496-3498884 + CDS yhfM EG12908 putative amino acid/amine transport protein

Reported regulatory sites for yhfL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.499 3497040-3497061 ttcat ATAATCAATGAATATTAATTAA tatat - 0 - 0.561 3496883-3496906 ctttt TATATATTCAGCAAATAAAACATA gcccc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back