yhgF
 
Information for yhgF, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3534414-3534926
+
CDS
transcription elongation factor and transcript cleavage
3535122-3537344
+
CDS
yhgF
orf; hypothetical protein
3537799-3538026
+
CDS
ferrous iron transport protein A
 
Reported regulatory sites for yhgF:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.552
3534951-3534972
gccga TGGCTGGCATTTTTGCCAGCCA gtccg
-
0
-
4.552
3535039-3535060
ttcgt TCTGCCGCATTATTGCGGGTGA aattc
-
0
-
3.943
3535093-3535114
cgctg CCGTTCGCCTGCTTGACGAAGG gaata
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.701
3535074-3535092
cgcgc CCGGAACAGGTTGACGCTG ccgtt
-
0
-
 
Critical MAP values:
p=0.01
4.80
p=0.05
3.45
p=0.1
2.95
p=0.2
2.42

Click here to go back