yhgI
 
Information for yhgI, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3542470-3543201
+
CDS
orf; hypothetical protein
3543260-3543835
+
CDS
yhgI
orf; hypothetical protein
3544195-3545508
+
CDS
high-affinity transport of gluconate / gluconate permease
 
Reported regulatory sites for yhgI:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.698
3543211-3543232
tcgat GATGGGCGTATTATAACCAACT aaaat
-
0
-
3.698
3543235-3543256
actaa AATAGTCAACTATTAGGCCATT actat
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Critical MAP values:
p=0.01
4.80
p=0.05
3.45
p=0.1
2.95
p=0.2
2.42

Click here to go back