yhgN
 
Information for yhgN, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3571408-3572511
-
CDS
aspartate-semialdehyde dehydrogenase
3572704-3573297
+
CDS
yhgN
orf; hypothetical protein
3573354-3573689
-
CDS
low-affinity gluconate transport permease protein; fragment 2
 
Reported regulatory sites for yhgN:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
0.935
3572678-3572697
agtcc GCGGCAATTATCAGGGAATT tgagt
-
0
-
0.814
3572596-3572613
cagcc AAAGTCGCAAGTGAAATT aatca
-
0
-
 
Critical MAP values:
p=0.01
4.11
p=0.05
2.92
p=0.1
2.48
p=0.2
2.01

Click here to go back