yhhA

Information for yhhA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3582712-3584454 - CDS ggt EG10374 gamma-glutamyltranspeptidase 3584574-3585014 + CDS yhhA EG11184 orf; hypothetical protein 3585001-3585744 - CDS ugpQ EG11050 glycerophosphodiester phosphodiesterase; cytosolic

Reported regulatory sites for yhhA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.599 3584457-3584474 catcg TTATTCTCCAGAGATTAA ggggc - 0 - 1.535 3584489-3584510 ccagc TAAGCCTGGTATATAACTCTGA attaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back