yhhK
 
Information for yhhK, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3594082-3595191
-
CDS
high-affinity leucine-specific transport system; periplasmic binding protein
3595615-3595998
+
CDS
yhhK
orf; hypothetical protein
3596186-3597346
-
CDS
high-affinity amino acid transport system; periplasmic binding protein
 
Reported regulatory sites for yhhK:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.279
3595512-3595528
ttgct GTTAAAAAATTAATCAC ctgcc
-
0
-
3.356
3595330-3595352
gatta AAATCCCTATTTTTCAGTCGATT aagaa
-
0
-
3.356
3595440-3595462
ggaat AATTCACTATCATTCAGGGGATT atgct
-
0
-
3.192
3595225-3595246
gttgc TTTGTTTTTATGTGTTAACAAA tcaga
-
0
-
3.192
3595374-3595395
ctgaa TTTATTGATAGATAAACAGAAA aaagt
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back