yhjB
 
Information for yhjB, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3667222-3668871
+
CDS
cytoplasmic trehalase
3668922-3669524
-
CDS
yhjB
putative regulator
3669972-3670943
+
CDS
putative transcriptional regulator LYSR-type
 
Reported regulatory sites for yhjB:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.908
3669589-3669608 R
ccgcc AAATGGCGAATTCTTATTTT ttctc
-
0
-
2.765
3669568-3669584 R
tttct CGCGGGTAATACCCTTC cacta
-
0
-
2.150
3669653-3669670 R
gttta GCTGTAACTATTTATATC ggtaa
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back