yhjJ

Information for yhjJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3676830-3677978 + CDS kdgK EG12253 ketodeoxygluconokinase 3678074-3679570 - CDS yhjJ EG12254 orf; hypothetical protein 3679791-3681077 - CDS dctA EG20044 uptake of C4-dicarboxylic acids

Reported regulatory sites for yhjJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.648 3679673-3679693 R ggttt ATTTCACTTCTTCCGTGACAT tttca - 0 - 3.290 3679638-3679656 R tgcgg TCTAACACGAAGTGTTTTT aacgt - 0 - 3.049 3679752-3679775 R tatgc CCGCACTCCCTTCCCCGAGTGCGG gtgtt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back