yhjK
 
Information for yhjK, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
3679791-3681077
-
CDS
uptake of C4-dicarboxylic acids
3681260-3683215
-
CDS
yhjK
orf; hypothetical protein
3683330-3686830
-
CDS
putative oxidoreductase subunit
 
Reported regulatory sites for yhjK:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.748
3683279-3683296 R
gctgc GATCGGGTATACTCGGGC ggcaa
-
0
-
3.468
3683305-3683327 R
taagt TTTCAGATAGCGCCTCTCTTAAT gccgc
-
0
-
3.468
3683227-3683249 R
gacaa TTTGCGCGTAAGTCGCTCGTTAA caatc
-
0
-
3.308
3683262-3683278 R
cgggc GGCAATCTGGGATTTCC ggggg
-
0
-
 
Critical MAP values:
p=0.01
6.03
p=0.05
4.63
p=0.1
3.98
p=0.2
3.37

Click here to go back