yhjK

Information for yhjK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3679791-3681077 - CDS dctA EG20044 uptake of C4-dicarboxylic acids 3681260-3683215 - CDS yhjK EG12256 orf; hypothetical protein 3683330-3686830 - CDS yhjL EG12257 putative oxidoreductase subunit

Reported regulatory sites for yhjK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.748 3683279-3683296 R gctgc GATCGGGTATACTCGGGC ggcaa - 0 - 3.468 3683305-3683327 R taagt TTTCAGATAGCGCCTCTCTTAAT gccgc - 0 - 3.468 3683227-3683249 R gacaa TTTGCGCGTAAGTCGCTCGTTAA caatc - 0 - 3.308 3683262-3683278 R cgggc GGCAATCTGGGATTTCC ggggg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back