yibF

Information for yibF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3757485-3758876 - CDS selA EG10941 selenocysteine synthase: L-seryl-tRNA (Ser) selenium transferase 3758974-3759582 - CDS yibF EG11762 putative S-transferase 3759810-3763943 + CDS rhsA EG10846 rhsA protein in rhs element

Reported regulatory sites for yibF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.084 3759693-3759716 R gagtg AAATAATTAGGAAAATATTTATAT cacca - 0 - 2.007 3759667-3759687 R cacca TGATAAATATGTGATTTATTT ggaag - 0 - 0.518 3759722-3759737 R cctga AGTGAGATATCCATCA gagtg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back