yibL

Information for yibL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3773199-3773786 + CDS mtlR EG11965 repressor for mtl 3774292-3774654 + CDS yibL EG11964 orf; hypothetical protein 3775026-3776681 + CDS lldP EG11961 L-lactate permease

Reported regulatory sites for yibL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.234 3773825-3773843 ggccg ATAAAGCCGACGATAATAC tccag - 0 - 3.234 3773952-3773970 atgcc ATGAAATCTACGGCTTTAT cgata - 0 - 2.997 3774083-3774103 atgac ATTAAGGAAAACGTGCTGAAT cctca - 0 - 2.930 3774195-3774216 aatga TTACGTTACAGAACTATTACAA tgtca - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back