yidY

Information for yidY, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3887865-3889112 + CDS tnaB EG11006 low affinity tryptophan permease 3889244-3890419 + CDS yidY EG11720 putative transport protein 3890394-3891353 + CDS yidZ EG11721 putative transcriptional regulator LYSR-type

Reported regulatory sites for yidY: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.717 3889155-3889171 tctca GGAAATCACTTATGTCC aaatg - 0 - 0.346 3889124-3889146 caaga AGCCAGCCATTCGCTGGCTTCTT gcctc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back