yigN

Information for yigN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4014018-4014779 + CDS udp EG11045 uridine phosphorylase 4014920-4016347 + CDS yigN EG11472 putative alpha helix chain 4016442-4017197 + CDS ubiE EG11473 2-octaprenyl-6-methoxy-1;4-benzoquinone --> 2-octaprenyl-3-methyl-6-methoxy-1;4-benzoquinone

Reported regulatory sites for yigN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.609 4014797-4014817 gtctg AAGGCCGACGCGTTCGGCCTT ttgta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.714 4014823-4014846 ttgta TTTTTGCGTAGCGCCTCGCAGGAA atgcc - 0 - 5.367 4014874-4014892 gtaca GCACAATTCTATTTTGTGC gggta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back