yihU

Information for yihU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4069353-4070231 - CDS yihT EG11846 putative aldolase 4070255-4071151 - CDS yihU EG11847 putative dehydrogenase 4071313-4072215 + CDS yihV EG11848 putative kinase

Reported regulatory sites for yihU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.877 4071260-4071283 R cattt TAATTTCACCAATTGTTTAAAAAG tgacg - 0 - 4.877 4071223-4071246 R gtcaa TTTTTTGACGATAAATTACAAATA cgatc - 0 - 1.349 4071173-4071189 R cataa ATGACAAAAAGTGACAT aactg - 0 - 1.182 4071183-4071198 R aaagc ATGTCATAAATGACAA aaagt - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back