yiiG

Information for yiiG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4083596-4084429 + CDS fdhD EG11859 affects formate dehydrogenase-N 4084582-4085637 + CDS yiiG EG11860 orf; hypothetical protein 4085688-4087436 - CDS frvR EG11861 putative frv operon regulatory protein

Reported regulatory sites for yiiG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.744 4084489-4084506 tttta TTATTTTATTTATAAACA aaatg - 0 - 1.945 4084430-4084453 attaa TTAAAATAAGTCCTGCGAAATATA ttaaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back