yjbB

Information for yjbB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4221407-4225090 + CDS metH EG10587 B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase; repressor of metE and metF 4225310-4226941 + CDS yjbB EG11919 putative alpha helix protein 4227032-4227721 - CDS pepE EG11920 peptidase E; a dipeptidase where amino-terminal residue is aspartate

Reported regulatory sites for yjbB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.283 4225126-4225142 aacag GGCGCTCAATGAGTGCC ctgtc - 0 - 1.952 4225106-4225125 tgtca CTTTTCCTTACAACAAACAG ggcgc - 0 - 1.952 4225147-4225166 cctgt CTCTTTATTAATATGAAACA cttat - 0 - 1.349 4225286-4225305 acata TAACGATAAGGAGAACCTGA actcg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back