yjcC

Information for yjcC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4272339-4272689 - CDS yjcB EG11937 orf; hypothetical protein 4273050-4274636 + CDS yjcC EG11938 orf; hypothetical protein 4274639-4274962 - CDS soxS EG10958 regulation of superoxide response regulon

Reported regulatory sites for yjcC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.049 4272722-4272744 caaaa ATGAAACACTCTGTTTGTTTCAT taatt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.508 4272750-4272767 taatt TTGTGAACTATATCACAA ttgat - 0 - 2.009 4272922-4272945 tgacg ATTAGAAAGGTATCAATTTCAAAT caggc - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back