yjcR

Information for yjcR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4298606-4300516 - CDS yjcQ EG11953 putative enzyme 4300657-4301688 - CDS yjcR EG11954 putative membrane protein 4302191-4304188 - CDS yjcS EG11955 orf; hypothetical protein

Reported regulatory sites for yjcR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.348 4302159-4302174 R tttgg GGGCGCTGAAGCCCCC aaaag - 0 - 0.943 4302059-4302074 R ctatt TTTATTCATCAAGAAA atagc - 0 - 0.081 4301870-4301892 R tatct CCGGCAATCCCGGTGATCGGCGC ttatt - 0 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back