yjcX

Information for yjcX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4307027-4308559 - CDS yjcW EG11959 putative ATP-binding component of a transport system 4308686-4309621 - CDS yjcX EG12458 putative LACI-type transcriptional regulator 4309680-4310603 - CDS rpiR EG12459 transcriptional repressor of rpiB expression

Reported regulatory sites for yjcX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.155 4309650-4309671 R aaagg TAATTCCGCCATCGCGGAGTTA cctgt - 0 -

Critical MAP values: p=0.01 3.18 p=0.05 2.36 p=0.1 2.00 p=0.2 1.60

Click here to go back