yjeI

Information for yjeI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4368603-4370249 + CDS mopA EG10599 GroEL; chaperone Hsp60; peptide-dependent ATPase; heat shock protein 4370354-4370740 + CDS yjeI EG12471 orf; hypothetical protein 4370943-4371812 - CDS yjeJ EG12472 orf; hypothetical protein

Reported regulatory sites for yjeI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.817 4370279-4370302 acaaa CCCCCGGGCAGAAATGTCTGGGGG ttttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.050 4370326-4370342 ttcta GTATAAGATTCAGACAC ggacg - 0 - 2.640 4370317-4370334 tggtc ATCTTTCTAGTATAAGAT tcaga - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back