yjgB

Information for yjgB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4492191-4492754 + CDS idnK EG12152 gluconate kinase; thermosensitive glucokinase 4492758-4493819 - CDS yjgB EG11436 putative oxidoreductase 4493973-4494057 + tRNA leuX EG30053 Leucine tRNA5 (amber [UAG] suppressor)

Reported regulatory sites for yjgB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.050 4493872-4493888 R ctaag TGCTGAAATTTTCAGCA ttgca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.535 4493949-4493965 R tgaag AGGTATGCGGAAAACGT tgtgg - 0 - 2.690 4493926-4493947 R acgtt GTGGATTATACCTGTCGCACGC cacca - 0 - 2.690 4493838-4493859 R cagcg ATGTGTAACCTTTGTCACACTC caggc - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back