yjgD

Information for yjgD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4474870-4475874 - CDS argI EG10069 ornithine carbamoyltransferase 1 4476036-4476452 + CDS yjgD EG12453 orf; hypothetical protein 4476597-4476890 - CDS b4256 EG12532 orf; hypothetical protein

Reported regulatory sites for yjgD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.539 4475900-4475917 gcctc AATGAATTAAAATTCAAT ttata argR 18 - 5.539 4475921-4475938 attta TATGGATGATTATTCATT tgcaa argR 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.728 4475993-4476016 tggtg TGTGACAATAAGAGTATCGGCAGG acatt - 0 - 1.820 4475940-4475961 cattt GCAAGTCTAAAGCATAAATCTT tgtca - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back