yjgK
 
Information for yjgK, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4472037-4472291
+
CDS
orf; hypothetical protein
4472427-4472888
+
CDS
yjgK
orf; hypothetical protein
4472975-4474825
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for yjgK:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.858
4472401-4472421
gatag AAATGAAACGTTGTTTTAATT aagga
-
0
-
1.645
4472330-4472351
tgccg ATAAGTTGTGATAAGACAATAA ttcac
-
0
-
1.313
4472384-4472400
ttatc TTTTCGTATAACGATAG aaatg
-
0
-
 
Critical MAP values:
p=0.01
6.66
p=0.05
5.31
p=0.1
4.59
p=0.2
3.95

Click here to go back