yjgR

Information for yjgR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4484883-4485968 + CDS yjgQ EG12536 orf; hypothetical protein 4486129-4487631 - CDS yjgR EG12537 orf; hypothetical protein 4487709-4488707 - CDS idnR EG12538 L-idonate transcriptional regulator

Reported regulatory sites for yjgR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.412 4487640-4487659 R ctata CTCCAGGCAGGAAACTGGAG gatat - 0 - - 0.273 4487651-4487667 R gacgt TGCCTATACTCCAGGCA ggaaa - 0 - -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back