yjhF
 
Information for yjhF, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4516906-4517706
-
CDS
orf; hypothetical protein
4518239-4519588
-
CDS
yjhF
putative transport system permease
4519695-4521662
-
CDS
putative dehydratase
 
Reported regulatory sites for yjhF:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.974
4519644-4519665 R
acctg AATTATCCGACTCTGCATCATT cgtta
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back