yjiO
 
Information for yjiO, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4563535-4564815
-
CDS
orf; hypothetical protein
4564856-4566088
-
CDS
yjiO
putative transport protein
4566567-4566878
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for yjiO:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
5.076
4566217-4566238 R
tttct CTGTCTGTGTGTTCACAGGCAG tgtgg
-
0
-
4.754
4566331-4566351 R
atttt AATTACACTTAAGGTGTATAT tttct
-
0
-
3.881
4566191-4566214 R
cagtg TGGTTGATTACATGAAATTCAGTA cattt
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back