yjiU
 
Information for yjiU, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4569935-4571500
+
CDS
orf; hypothetical protein
4571704-4573245
+
CDS
yjiU
orf; hypothetical protein
4573163-4574425
+
CDS
inhibits McrE 5-methylcytosine restriction system
 
Reported regulatory sites for yjiU:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.144
4571579-4571597
ggatc CCGCATTTCTTAAAGTCAG ggcgc
-
0
-
2.126
4571590-4571609
ttctt AAAGTCAGGGCGCATATCTT ccagc
-
0
-
1.970
4571566-4571585
aacct AATGCAAAGGATCCCGCATT tctta
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back