yjjI

Information for yjjI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4612249-4613112 - CDS yjjW EG12599 putative activating enzyme 4613084-4614634 - CDS yjjI EG12171 orf; hypothetical protein 4614892-4615671 + CDS deoC EG10221 2-deoxyribose-5-phosphate aldolase

Reported regulatory sites for yjjI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.432 4614832-4614847 R gagtt TGTTAGTATTCTAACA tctac deoR 16 - 3.892 4614797-4614816 R aacac ACTTCGATACACATCACAAT taagg crp 20 - 3.892 4614744-4614763 R actgt AATGCGATCTGGTTCAAATA attca crp 20 - 1.278 4614764-4614781 R tactt ACAAGTTTGCATCACTGT aatgc cytR crp 14 1 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back