yjjK
 
Information for yjjK, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4624863-4626116
+
CDS
probable nadAB transcriptional regulator
4626424-4628091
-
CDS
yjjK
putative ATP-binding component of a transport system
4628275-4630239
+
CDS
soluble lytic murein transglycosylase
 
Reported regulatory sites for yjjK:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.290
4628193-4628212 R
cacgt TACGGACACTTTTTTACTTT tactg
-
0
-
3.290
4628133-4628152 R
gggaa AAAGGCTACACTTCGCCTTT gaaaa
-
0
-
1.736
4628254-4628272 R
catca ATGCAGCGTCATGCCGCGT aatag
-
0
-
1.736
4628110-4628128 R
tgaaa ACTCATTATCACGATAAAC ataga
-
0
-
1.151
4628226-4628249 R
taata GATTTATGCTAACCAGTCATTGCC gttta
-
0
-
1.151
4628159-4628182 R
cgagg GTGATCGACCGGCTGGGATTAGGC gggga
-
0
-
 
Critical MAP values:
p=0.01
4.80
p=0.05
3.45
p=0.1
2.95
p=0.2
2.42

Click here to go back