yjjK

Information for yjjK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4624863-4626116 + CDS nadR EG11335 probable nadAB transcriptional regulator 4626424-4628091 - CDS yjjK EG12343 putative ATP-binding component of a transport system 4628275-4630239 + CDS slt EG10950 soluble lytic murein transglycosylase

Reported regulatory sites for yjjK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.290 4628193-4628212 R cacgt TACGGACACTTTTTTACTTT tactg - 0 - 3.290 4628133-4628152 R gggaa AAAGGCTACACTTCGCCTTT gaaaa - 0 - 1.736 4628254-4628272 R catca ATGCAGCGTCATGCCGCGT aatag - 0 - 1.736 4628110-4628128 R tgaaa ACTCATTATCACGATAAAC ataga - 0 - 1.151 4628226-4628249 R taata GATTTATGCTAACCAGTCATTGCC gttta - 0 - 1.151 4628159-4628182 R cgagg GTGATCGACCGGCTGGGATTAGGC gggga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back