yjjN

Information for yjjN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4592507-4593313 - CDS yjjM EG12589 orf; hypothetical protein 4593544-4594581 + CDS yjjN EG12590 putative oxidoreductase 4594719-4596971 - CDS mdoB EG12591 phosphoglycerol transferase I

Reported regulatory sites for yjjN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.426 4593464-4593487 acatt TTTATGCGTGTGTTTTCACAAAAA agatt - 0 - 1.773 4593438-4593461 gtgag TCCATTAAAACCCGATTTAAAACA ttttt - 0 - 1.376 4593350-4593368 aaggg ATATGACCCCGCGCCATAT catca - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back