yliI

Information for yliI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 877471-877854 + CDS b0836 EG13479 putative receptor 877965-879080 + CDS yliI EG13480 putative dehydrogenase 879077-879709 - CDS yliJ EG13481 putative transferase

Reported regulatory sites for yliI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.613 877890-877910 catgt TTAAGTTTTTGTAAAAATGAA tttgt - 0 - 4.825 877865-877882 aaggg GGAGAAAGCGTCTCCCCC ttcat - 0 - 4.670 877929-877950 ccact GACTACGCTTTAAGCCAGAGTC aatcc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back