yliJ

Information for yliJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 877965-879080 + CDS yliI EG13480 putative dehydrogenase 879077-879709 - CDS yliJ EG13481 putative transferase 879950-881152 + CDS dacC EG10203 D-alanyl-D-alanine carboxypeptidase; penicillin-binding protein 6

Reported regulatory sites for yliJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.420 879828-879847 R agttg GTAAAGTTTTTAAAGTTTAT gcaat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.078 879839-879860 R taaag AAACCGTAAGTTGGTAAAGTTT ttaaa - 0 - 2.438 879875-879890 R gtttg GTGATTAATAACGCAC acaca - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back