ynhG

Information for ynhG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1755445-1755681 + CDS lpp EG10544 murein lipoprotein 1755745-1756749 - CDS ynhG EG14015 orf; hypothetical protein 1756898-1757314 - CDS ynhA EG13961 orf; hypothetical protein

Reported regulatory sites for ynhG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.042 1756881-1756900 R ttagc TAAACTAAAAGGACAGCTTT catcc - 0 - 0.665 1756782-1756805 R gtgaa CATAAGCGCCATCCGACGTTTCAG cgtga - 0 - 0.553 1756822-1756843 R tgttt ACACTGACCTGCACAGGAGTGT tttgg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back