ynhG
 
Information for ynhG, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
1755445-1755681
+
CDS
murein lipoprotein
1755745-1756749
-
CDS
ynhG
orf; hypothetical protein
1756898-1757314
-
CDS
orf; hypothetical protein
 
Reported regulatory sites for ynhG:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.042
1756881-1756900 R
ttagc TAAACTAAAAGGACAGCTTT catcc
-
0
-
0.665
1756782-1756805 R
gtgaa CATAAGCGCCATCCGACGTTTCAG cgtga
-
0
-
0.553
1756822-1756843 R
tgttt ACACTGACCTGCACAGGAGTGT tttgg
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back